香京julia种子在线播放

All berries at different stages were harvested from wild Wufanshu plants in Lianjiang, in the city of Fuzhou (Fujian Province, China). Green berries were harvested on June 19, 2016. Red and black berries were harvested on November 16, 2016 and divided into two groups according to color. We estimated that these berry stages approximately correspond with stages 5, 6, and 8, described by for blueberry (Zifkin et al., 2011). Berries sampled from three different plants were used as biological replicates. For each plant, berries with similar size and color were pooled together. After harvesting, all samples were transported to lab and immediately frozen in liquid nitrogen and kept at −80°C for further analysis.

Approximately 1 g (FW) of whole berries was ground to fine powder in liquid nitrogen and extracted with 10 mL extraction solution (0.05% HCl in methanol) at 4°C for 24 h. Anthocyanin content was quantified using pH differential method as described previously (Fang et al., 2016).

Extraction, identification and quantification of metabolites were carried out at Suzhou BioNovoGene (Suzhou, China). Approximately 0.2 g (FW) of the berry powder was transferred to a 2 mL centrifuge tube containing 1 mL of water: methanol: formic acid (66.5: 28.5: 5, v/v/v), incubate on ice for 30 min and centrifuged at 18,756 × g for 10 min. The tube containing the mixture was centrifuged at 12,000 rpm for 10 min. The supernatants were freeze-dried and the extracts were resuspended with 0.2 mL 5% formic acid. An Ultra-high performance chromatography system (UHPLC, Vanquish, Thermo Fisher Scientific, Waltham, MA, United States) with a Waters HSS T3 (2.1 × 100 mm, 1.8 μm) column was used. The parameters used were as follows: flow rate of 300 μL min^–1, column oven temperature of 40°C, and sample size of 2 μL. The mobile phases were 0.1% formic acid in water (A) and 0.1% formic acid in acetonitrile (B). The gradient elution procedure was as follows: 0-4.0 min, 10% A; 4.0-12.0 min, 10–60% A; 12.0–18.0 min, 60% A constant; 18.0–18.1 min, 60-10% A; 18.1–26.0 min, 10% A constant. Mass spectrometry (MS) analysis was carried out on a Thermo Q Exactive instrument (Thermo Fisher Scientific, Waltham, MA, United States) equipped with an electrospray ion (ESI) source in positive mode. The capillary voltage was set to 3000 V and the capillary temperature was set to 320°C. The pressure of sheath gas and auxiliary gas were set at 40 and 10 arbitrary units, respectively. Metabolites were detected using full-scan/MS2 mode with a resolution of 70000. ESI spectra were acquired through the information-dependent acquisition mode in Xcalibur 4.1 software (Thermo Fisher Scientific, Waltham, MA, United States). The dynamic exclusion time was set to 6s. For MS1, full MS spectra between 200 and 1500 mass-to-charge ratio (m/z) were recorded. MS/MS scans were recorded between 200 and 2000 m/z. Data dependent acquisition survey scans were acquired in 100 ms and the 10 most abundant product ion scans were collected. Each metabolite was confirmed based on their exact molecular weights, then the fragment information obtained according to the MS/MS mode was matched in database built by BioNovogene to identify metabolites. Searches were performed using the following settings: precursor ion m/z tolerance: ±10ppm; MS/MS m/z tolerance: ±20ppm.

For RNA-Seq, berries at green or black stage from three replicates were mixed and subjected to RNA extraction. Total RNA extraction, cDNA library construction, and sequencing were performed by staff at Beijing BioMarker Technologies (Beijing, China). RNA extraction was carried out using EZNA Plant RNA Kit (Omega Bio-tek) RNA purity was checked using the NanoPhotometer^® spectrophotometer (IMPLEN, CA, United States). RNA concentration was measured using Qubit^® RNA Assay Kit in Qubit 2.0 Fluorometer (Life Technologies, CA, United States). RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, United States). cDNA library was generated using NEBNext^®Ultra^TM RNA Library Prep Kit for Illumina^®(NEB, United States) following manufacturer’s recommendation. Library quality was assessed using the Agilent Bioanalyzer 2100 system. Sequencing of the cDNA libraries were carried out on the Illumina HiSeq^TM X Ten sequencing platform. The RNA-seq reads have been deposited in the NCBI Short Read Archive and are accessible under PRJNA694726.

The raw reads were processed through in-house perl scripts and de novo assembled into unigenes with Trinity (Grabherr et al., 2011) as described previously (Zhang et al., 2018). Annotation of the assembled unigenes was performed using BLASTx (E-value<10–5) searches against eight public databases including the NCBI non-redundant protein database (Nr), Swiss-Prot protein database (Swiss-Prot), the Gene Ontology database (GO), the Clusters of Orthologous Groups database (COG), the euKaryotic Ortholog Groups of proteins database (KOG), the Kyoto Encyclopedia of Genes and Genomes (KEGG), the Pfam-protein family database (Pfam) and the evolutionary genealogy of genes: Non-supervised Orthologous Groups database (eggNOG). For calculation of gene expression level, clean RNA-Seq reads were mapped to the assembled unigenes using Bowtie (Langmead et al., 2009) and the expression levels of unigenes were calculated with fragments per kilobase per million mapped reads (FPKM) using RSEM (Li and Dewey, 2011).

Total RNA was extracted from green, red and black Wufanshu berries using EZNA Plant RNA Kit (Omega Bio-tek). First strand cDNA was prepared from 500 ng total RNA HiScript III RT SuperMix for qPCR with gDNA wiper (Vazyme, Nanjing, China). qRT-PCR was performed using the Eppendorf Realplex⁴ real-time PCR system (Hamburg, Germany) in a total volume of 20 μL in each well containing 10 μL of 2 × ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China), 6 μL of cDNA (in 1:30 dilution), and 0.4 μL 10 μM primers. qRT-PCR conditions were 30 s at 95°C, followed by 40 cycles of 5 s at 95°C, 15 s at 60°C, followed by 60°C to 95°C melting curve detection. Actin gene (c87909.graph_c0) was used as the reference. The expression levels were calculated using the 2^–ΔΔCT method. Three biological and four technical replications were performed. Primers for qRT-PCR were listed in Supplementary Table 1. Linear regression analysis of FPKM and qPCR was performed using Minitab^® 18.

cDNA of black Wufanshu berries was generated using a First-Strand cDNA synthesis kit (Fermentas, United States) and used as template for gene cloning. The cDNA sequence encoding VbMYBA was isolated using I-5^TM 2 × High-Fidelity Master Mix (MCLAB, San Francisco, CA) with primers (forward 5′-GGCAGCTTACATGAAAATTCTCC-3′ and reverse 5′-CAAACAAAGAAATGCTTGCCG-3′) designed according to unigene sequence. The generated PCR products were purified and subsequently cloned into the pEASY-Blunt Zero vector using pEASY-Blunt Zero Cloning Kit (TransGen, Beijing, China) and sequenced. The open-reading frame of the sequence was predicted using GenBank ORF finder¹.

Multiple sequence alignment of R2R3 MYB amino acid sequences from Wufanshu, blueberry, kiwifruit and peach was performed by CLUSTALW². Shading of the alignment results was performed using ESPript 3.0 (Robert and Gouet, 2014). Phylogenetic tree was constructed using the maximum likelihood method with 1000 bootstrap replicates by MEGA-X. R2R3 MYB amino acid sequences used for phylogenetic analysis include Arabidopsis thaliana AtMYB4 (At4G38620), AtMYB11 (AT3G62610), AtMYB12 (AT2G47460), AtMYB75 (AT1G56650), AtMYB90 (AT1G66390), AtMYB111 (AT5G49330), AtMYB113 (AT1G66370), AtMYB114 (AT1G66380), AtMYB123 (AT5G35550); Actinidia chinensis AcMYB10 (PSS35990), and AcMYB110 (AHY00342); Fragaria × ananassa FaMYB1 (AAK84064.1), FaMYB9 (JQ989281), FaMYB10 (ABX79947.1); Gossypium hirsutum GhMYB1 (AAA33067.1), GhMYB6 (AAN28286.1) GhMYB10 (ABR01222.1), and GhMYB36 (AF336284); Lotus japonicus LjMYB12 (AB334529); Myrciaria cauliflora McMYB (MH383068); Malus × domestica MdMYB1 (XP_028963316.1), MdMYB9 (DQ267900), MdMYB10 (EU518249), MdMYB11 (DQ074463); Medicago truncatula MtLAP1 (ACN79541.1), and MtMYB14 (XP_003594801.1); Prunus cerasifera PcMYB10.1 (KP772281) and PcMYB10.2 (KP772282); Petunia hybrida PhMYB27 (AHX24372), PhAN2 (AB982128), PhDEEP PURPLE (ADQ00393.1), PhPURPLE HAZE (ADQ00388.1) and PhMYB4 (ADX33331.1); Prunus persica PpMYB10.1 (XM_007216468), PpMYB10.2 (XM_007216161) and PpMYB18 (KT159234); Prunus salicina PsMYB10.1 (MK105923), PsMYB10.2 (MK340932), and PsMYB18 (MK284223); PtMYB14 (ACR83705.1); Pyrus pyrifolia PyMYB10 (GU253310); Solanum lycopersicum SlMYB12 (ACB46530.1); Trifolium arvense TaMYB14 (AFJ53053.1); Trifolium repens TrMYB4 AMB27079), TrMYB133 (AMB27081), and TrMYB134 (AMB27082); Vaccinium ashei VaMYB (QOQ50851.1), Vaccinium corymbosum VcMYBA (MH105054); Vaccinium uliginosum VuMYBC2; Vitis vinifera VvMYBA2 (BAD18978), VvMYBF1 (ACV81697), VvMYBC2-L1 (AFX64995.1), VvMYB-L2 (ACX50288.2), and VvMYBPA2 (ACK56131.1).

Full-length coding sequence of VbMYBA was isolated using 2 × Phanta Max Master Mix (Vazyme, Nanjing, China) with primer VbMYBAOEF and VbMYBAOER and inserted into pSAK277. A fragment (70–855 bp) of VbMYBA was amplified by primer VbMYB-NdelOEF and VbMYB-NdelOER. Fusion PCR was carried out to generate VcMYBA-Nadd (VcMYBA with 1–69 bp of VbMYBA) were constructed as following: the N-terminal of VbMYBA (1–69 bp) was amplified by primer VbMYBNF and VbMYBNR, and the VcMYBA contains overlap with N-terminal of VbMYBA (1–69 bp) was amplified by VcMYBF and VcMYBR. Then the two fragments were fused through PCR. Finally, the VcMYBA-Nadd was amplified by primer VbMYB-NaddOEF and VbMYB-NaddOER, and inserted into pSAK277. The insertion of PCR fragments into pSAK277 was conducted using ClonExpress Ultra One Step Cloning Kit (Vazyme, Nanjing, China). Primer sequences used for the vector construction are listed in Supplementary Table 2. The promoter of VcDFR was previously isolated (Plunkett et al., 2018) and the promoter of VavUFGT was isolated from Vaccinium virgatum using the primers VavpUFGT-F (CTCCACATTTTTAACCTGGTGCAC) and VavpUFGT-R (CATGGTTATATTTTTGGTGGT), and cloned into pGreenII 0800-LUC (Hellens et al., 2005).

Transient color assays were carried out in young leaves of Nicotiana tabacum seedlings grown in the greenhouse as described previously (Fang et al., 2021). All the constructs were transformed into Agrobacterium tumefaciens strain GV3101, and incubated at 28°C for 2 days. Agrobacterium cultures carrying constructs were resuspended in infiltration buffer containing 10 mM MgCl₂ and 100 μM acetosyringone (pH = 5.7) and incubated at room temperature without shaking for 2 h before infiltration. Mixed bacterial cultures were injected into the abaxial side of young leaves. Many studies have suggested that basic helix-loop-helix (bHLH) transcription factors are indispensable partners of R2R3-MYBs (Espley et al., 2007; Gonzalez et al., 2008), in particular those belonging to the bHLH2 subgroup (PhAN1/AtTT8). Tobacco leaves express WDR and bHLH1 (PhJAF13/AtEGL3) orthologs, but require a bHLH2 (PhAn1/AtTT8) protein to fully regulate anthocyanin biosynthesis (Montefiori et al., 2015). Because the ability for the MYB to regulate the endogenous tobacco bHLH2 gene is variable in transient assays, a bHLH2 (PsbHLH3) gene was co-transformed. We failed to clone the anthocyanin-associated bHLH from Wufanshu, and so we chose the plum anthocyanin-activating PsbHLH3 for transient color assays in tobacco leaves (Fang et al., 2021). This is a close homolog of peach PpbHLH3, which showed stronger anthocyanin-promoting activity than the homologous apple MdbHLH3 when coinfiltrated with blueberry VcMYBA (Plunkett et al., 2018). Separate strains containing VbMYBA and PsbHLH3 fused to the 35S promoter in the pSAK277 vector and empty pSAK277 vector were infiltrated or co-infiltrated into the abaxial leaf surface. Blueberry VcMYBA (Plunkett et al., 2018) co-infiltrated with PsbHLH3 was used as positive control. Each infiltration was performed using three leaves from the same plants. Photographs were taken seven days after infiltration.

For quantification of anthocyanins, 10 mg of freeze-dried tobacco leaves from the infiltrated area was mixed in 1 mL of methanol: water: formic acid (80: 19.5: 0.5, v/v/v) and shaken for 4 h at room temperature. The tube containing the mixture was centrifuged at 10,000 × g for 15 min. The supernatants were filtered through a 0.45 μm PTFE syringe filter and submitted to high performance liquid chromatography (HPLC) analysis according to a method reported by Andre et al. (2012) with a few modifications. Briefly, quantification of the anthocyanins was performed using a Dionex Ultimate 3000 system (Sunnyvale, CA, United States) equipped with a diode array detector (DAD). A 5 μL aliquot was injected onto a Thermo C18 Acclaim PolarAdvantage II column (150 × 2.1 mm i.d.; 3 μm particle size) (Waltham, MA, United States). The mobile phases were (A) H₂O with 5% formic acid and (B) MeCN with 0.1% formic acid. The flow rate was 0.35 mL min^–1, and the column temperature was 35°C. The 28 min gradient was as follows: 0-5 min, 7% B constant; 5-10 min, 7-12% B; 10-20 min, 12-25% B; 20-21 min, 25-100% B; 21-24 min, 100% B constant; 24 min, 7% B; 24-28 min, 7% B re-equilibration time. Monitoring was set at 520 nm for quantification. Anthocyanins were identified by their spectral data and were quantified as cyanidin-3-glucoside using five-point calibration curves. A validation standard was injected after every 10th injection.

Dual-luciferase assays were conducted in Nicotiana benthamiana leaves as reported previously (Lin-Wang et al., 2010). All the promoter constructs were individually transformed into Agrobacterium strain GV3101 that contains the pSoup plasmid using the electroporation method. Agrobacteria cultivation and infiltration preparation were performed according to the same protocol as described above for the transient color assay.

The skin of unripe Wufanshu berries was initially green, then turned red and finally black when fully ripen (Figure 1A). The total content in anthocyanins increased during the ripening of berries and reached 516.97 mg/100 g FW at the full ripe stage (Figure 1B). Individual anthocyanin compounds were characterized in ripe Wufanshu berries using UHPLC–MS/MS analysis. Delphinidin, cyanidin, malvidin, peonidin, petunidin, as well as pelargonidin derivatives could be identified based on their mass spectral data. Delphinidin 3-galactoside and 3-glucoside predominated the anthocyanin profile (Supplementary Table 3).

To identify genes responsible for anthocyanin accumulation in the berries of Wufanshu and investigate the underlying molecular mechanisms, transcriptomes of berries at green and black stages were generated by RNA-Seq. A total of 13.49 Gb clean reads were generated (Supplementary Table 4) and de novo-assembled into 87,811 unigenes. The average length of unigenes was 672.45 nt. Over one-half of the unigenes (61.59%) were shorter than 500 bp, and only 18.59% (16,319) of the unigenes were longer than 1 kb (Supplementary Table 5).

All unigenes were annotated against eight public protein databases; NR, Swiss-Prot, Pfam, GO, COG, KOG, eggNOG4.5 and KEGG. In total, 49.37% (43,355) of the unigenes showed significant BLAST matches to known sequences in these databases (Supplementary Table 6). According to the KEGG enrichment analysis, 168 unigenes were assigned to phenylpropanoid biosynthesis pathway (ko00940), 48 unigenes were assigned to flavonoid biosynthesis pathway (ko00941) and fourteen genes were involved in the anthocyanin biosynthesis pathway (ko00942) (Supplementary Table 7). Twenty-seven of these genes, which were more abundant in transcript levels in black Wufanshu berries (Supplementary Table 8), were identified as candidate genes involved in anthocyanin biosynthesis. c81310.graph_c0 was annotated as leucoanthocyanidin dioxygenase according to Swissprot database and c84705.graph_c0 was annotated as UDP-glucose: flavonoid 3-O-glucosyltransferase according to Nr database (Supplementary Table 8). In addition, c72505.graph_c0 was predicted to encode a homolog of cyclamen CkmGST3, reported to be involved in anthocyanin accumulation (Kitamura et al., 2012).

Based on the RNA-Seq data, the expression levels of 11 anthocyanin biosynthetic genes with high FPKM values (maximum FPKM > 40) were analyzed by qRT-PCR. Our results indicated that the expression of VbPAL (phenylalanine ammonia-lyase, c84812.graph_c0), Vb4CL (4-coumaroyl:CoA-ligase, c83421.graph_c0), VbC4H (cinnamate-4-hydroxylase, c88472.graph_c0), VbCHS (chalcone synthase, c82998.graph_c0), VbF3H (flavanone-3-hydroxylase, c85319.graph_c0 and c78308.graph_c0), VbF3′H (flavonoid3′-hydroxylase, c88140.graph_c0), VbF3′5′H (c94417.graph_c2), VbDFR (dihydroflavonol-4-reductase, c76847.graph_c0), VbUFGT (UDPglucose:flavonoid-3-O-glucosyltransferase, c84705.graph_c0), and VbGST (glutathione S-transferase, c81305.graph_c0) were upregulated during ripening of Wufanshu berries (Figures 2A–K). Linear regression analysis showed that qRT-PCR value of the analyzed anthocyanin biosynthetic genes was significantly correlated with that FPKM value of them (Figure 2L).

To identify candidate anthocyanin MYB activators, amino acid sequence of VcMYBA (Plunkett et al., 2018) from blueberry was used as query to BLAST against the assembled unigene sequences using TBtools (Chen et al., 2020). The BLAST analysis enabled the identification of a unigene (c67315.graph_c0) encoding MYB protein. The full-length open-reading frame of c67315.graph_c0 was amplified from cDNA of Wufanshu berries and confirmed by sequencing. The gene was designated as VbMYBA (GenBank Accession No. MW543447) (Supplementary Figure 1). BLASTp search against NCBI non-redundant protein sequences showed that VbMYBA protein have highest matching score to VcMYB1 (AYC35399.1) from V. corymbosum. Sequence alignment analysis indicated that VbMYBA protein showed high sequence identity to blueberry VcMYB1 and VcMYBA and contains conserved R2R3 domain and SG6 motif for anthocyanin-promoting MYBs (Figure 3). Nineteen amino acids, three in each R domain and 12 in C-terminal, were different between VbMYBA and VcMYBA (Figure 3). In addition, the N-terminal of VbMYBA protein was 6 aa and 23 aa longer than blueberry VcMYB1 and VcMYBA, respectively (Figure 3). Phylogenetic analysis showed that VbMYBA belongs to SG6 clade, which contains anthocyanin-activating MYB proteins from other plant species and is closely related to the anthocyanin-activators from Vaccinium species (Figure 4).

Multiple sequences alignment and phylogenetic analysis suggested that VbMYBA was an anthocyanin-activator, similar to VcMYBA. RNA-Seq data along with qRT-PCR analysis indicated that the expression of VbMYBA was closely associated with that of anthocyanin biosynthetic genes and anthocyanin accumulation (Figure 5A). The function of VbMYBA was verified using tobacco leaf transient expression assays. Our results indicated that infiltration of VbMYBA with or without PsbHLH3 resulted in strong red pigmentation at infiltration sites 5 days after transformation, but only faint red coloration was found when VcMYBA and PsbHLH3 were co-infiltrated (Figure 5B). Anthocyanin content analysis in leaves of N. tabacum indicated that no anthocyanin was detected in the infiltrated areas transformed with empty vector or PsbHLH3 (Figure 5C). A high concentration of anthocyanin was detected in tobacco leaves infiltrated with VbMYBA, while co-infiltration of VbMYBA and PsbHLH3 did not result in stronger anthocyanin accumulation in tobacco leaves (Figure 5C). However, the anthocyanin content in tobacco leaves infiltrated with VcMYBA and PsbHLH3 was significantly lower than that in tobacco leaves infiltrated with VbMYBA with or without PsbHLH3 (Figure 5C). Among the anthocyanins detected in tobacco leaves, anthocyanin 1 and 2, which were likely correspond to a cyanidin-3-rutinoside and delphinidin-3-rutinoside, respectively, according to their UV spectra and literature data, were the predominant forms (Figure 5C). In addition, we employed dual-luciferase assays to investigate the function of VbMYBA. The promoters of VcDFR and VavUFGT from blueberry (V. corymbosum and V. virgatum, respectively) were fused to a luciferase reporter. Infiltration of VbMYBA led to strong activation of promoters VcDFR and VavUFGT (Figures 5D,E). These results demonstrate that VbMYBA is a strong anthocyanin activator and is capable of activating the promoters of DFR and UFGT from blueberry.

Since the sequence for VbMYBA contained a 23 amino acid-residue insertion in the N-terminal region compared with VcMYBA, we hypothesized that the N-terminal amino acid residues 1-23 of VbMYBA (N^1–23) are responsible for the capacity for higher anthocyanin-promoting activity. To investigate whether the N^1–23 is responsible for the divergence of anthocyanin-promoting activity between VbMYBA and VcMYBA, two mutant constructs were generated by deleting the N^1–23 in VbMYBA (VbMYBA-Ndel) and fusing the N^1–23 to VcMYBA (VcMYBA-Nadd) (Figure 6A). Anthocyanin-promoting activities of the mutant constructs were tested by tobacco leaf transient expression assays. Our results indicated that deletion of N^1–23 in VbMYBA or insertion of N^1–23 to VcMYBA have no significant effects on anthocyanin content in infiltrated tobacco leaves (Figures 6B–E). These results demonstrated that the N-terminal amino acid residues 1-23 of VbMYBA was not responsible for the divergence of anthocyanin-promoting activity between VbMYBA and VcMYBA.