香京julia种子在线播放

Animal experiments were conducted in strict adherence to the Swiss Law for Animal Protection and were approved by the cantonal veterinary office in Zürich under license number 57/2015 and 83/2018. C57Bl/6J mice were obtained from Janvier (France) and bred in-house to generate male mice (n = 32, 5 months old) for experiments. Mice were housed in groups of 3–5 animals in individually ventilated cages. Animals were kept in a temperature- and humidity-controlled facility on a 12 h reversed light/dark cycle (light on at 20:00, off at 8:00) with food (M/R Haltung Extrudat, Provimi Kliba SA, Switzerland) and water ad libitum. Cages were changed weekly.

Epididymidis from both sides was incised by several cuts with a fine scissor and placed in 2 ml M2 medium (M7167-100 ml, Sigma-Aldrich). Sperm cells were incubated at 37°C for 30 min. 1 ml of supernatant containing motile sperm was collected and centrifuged at 2,000 rcf for 5 min. The supernatant was again collected, mixed with 1 ml of somatic cell lysis buffer (0.1% sodium dodecyl sulfate and 0.05% Triton X-100 in MilliQ water) and incubated at 4°C for 10 min. Sperm samples were centrifuged at 2,000 rcf for 5 min, sperm pellets were washed twice in phosphate buffer saline (10010-015, Gibco) then snap-frozen and stored at −80°C until further processing. For lysis experiments, sperm samples were immediately resuspended in 250 μl water, lysis solutions were added and sperm observed under a light microscope.

Sperm pellets and small pieces of testis, liver or epididymis were lysed in 1 ml of Trizol (15596026, Life Technologies) or 1 ml of Buffer RLT+ (1053393, Qiagen) depending on the experiments. Lysis buffer was supplemented with 100 mM β-mercaptoethanol (M3148, Sigma-Aldrich), 100 mM dithiothreitol (646563-10X.5ml, Sigma-Aldrich) or 100 mM tris(2-carboxyethyl)phosphine (646547-10 × 1ml, Sigma-Aldrich). Sperm samples were either resuspended in lysis buffer by passage through a 30 G syringe or in the presence of 0.2 mm steel beads (SSB02-RNA, NextAdvance) at 20 Hz for up to 10 min in a TissueLyser II (85300, Qiagen). Since the lysis of sperm cells depends primarily on chemical lysis, we recommend future users a simple homogenization to sufficiently break up the cell pellet to obtain a single-cell suspension using 5 mm steel beads for 2 min (69989, Qiagen). We did not observe any differences between sperm lysis using small or large steel beads. Tissue samples were homogenized in a TissueLyser II using 5 mm steel beads at 20 Hz for 2 min.

For RNA extraction by phenol chloroform phase separation, 100 μl of sample lysed in Buffer RLT+ were added to 900 μl Trizol and extracted using the standard Trizol protocol. All centrifugation steps were at 4°C and samples kept on ice unless noted otherwise. In brief, 200 μl chloroform was added to 1 ml lysate, shaken for 15 s and then incubated at room temperature for 3 min. Samples were centrifuged at 12,000 rcf for 15 min. The aqueous phase was transferred to a fresh tube, 10 μl glycogen was added and the tube inverted 4 times for mixing. 500 μl isopropanol was then added and the tube inverted again 4 times. After an incubation at room temperature for 10 min, samples were centrifuged at 12,000 rcf for 10 min. The supernatant was removed and the pellet washed twice in 75% ethanol. After a final centrifugation at 7,500 rcf for 5 min, the supernatant was carefully removed. The pellet was dried in a concentrator (Speed-vac, Eppendorf) at 45°C for 4–6 min. Sperm RNA was resuspended in 20 μl nuclease-free water and tissue RNA in 100 μl nuclease-free water (A7398,500, ITW Reagents). Finally, the solution was incubated at 55°C for 15 min. RNA was stored at −80°C.

RNA concentration and integrity were analyzed on the 2100 Bioanalyzer (G2939BA, Agilent) with the RNA 6000 Pico Kit (5067-1513, Agilent) according to manufacturer instructions. DNA content was quantified by fluorometry with the Qubit double-strand DNA high sensitivity assay (Q32852, Invitrogen) according to manufacturer instructions. For RT-PCR of long RNAs, RNA samples were first DNase treated with the DNA-free Kit (AM1906, Invitrogen) and reverse-transcribed with the GoScript Reverse Transcription System (A5000, Promega) using random hexamers according to manufacturer instructions. A testis sample without GoScript reverse transcriptase (noRT) and a sample without RNA (no Input) was processed in parallel and served as negative controls. For qPCR of cDNA from long RNAs, 1 μl of cDNA per well was quantified using SYBR Green I Master (04887352001, Roche) and primers for β-actin (Forward (5′–3′): CGATGCCCTGAGGCTCTTTT, reverse (5′–3′): TAGAGGTCTTTACGGATGTCAACG). For end-point PCR of cDNA from long RNAs, 5 ng of cDNA was amplified by GoTaq G2 HS Polymerase (M7405, Promega) for 30 cycles using specific primers for Malat1 (Forward (5′–3′): ATCGATTTAAAGTAAATGGGCTA, reverse (5′–3′): TTACATGCAGGAACATTGACA) and Pgk2 (Forward (5′–3′): AAGTTTGATGAGAATGCTAAAGT, reverse (5′–3′): CCTCCTCCTATAATGGTGACA). PCR products size was assessed by agarose gel electrophoresis. In Figure 6F, a part of the gel between the DNA ladder and Malat1 PCR products was cut out because it contained an RT-PCR with a different primer set. For qPCR of miRNAs, RNA samples were reverse transcribed with miScript II RT reagents (218161, Qiagen) using HiFlex buffer. RT-qPCR was performed with QuantiTect SYBR Green PCR Kit (1046470, Qiagen) on a Light Cycler II 480 (Roche) using miScript Primers Assays (Qiagen) for miR-141 (MS00011165, Qiagen), miR-101b (MS00023919, Qiagen) and miR-200c (MS00032543, Qiagen). All samples were run in triplicate. Melt curve analysis confirmed amplification of single products for each primer.

The reduction of disulfide bonds was performed as described previously (Han and Han, 1994). 1 mM 2,2′-dithiodipyridine (43791-1G, Sigma-Aldrich) was prepared in nuclease-free water and stored at 4°C. Lysis buffers were prepared as follows and used for absorption reference measurement: Trizol, Buffer RLT+, 1 M guanidinium thiocyanate (G9277-100g, Sigma-Aldrich) in nuclease-free water, 50 mM β-mercaptoethanol (βME) in nuclease-free water, Trizol supplemented with 50 mM βME (Trizol/βME), Buffer RLT+ supplemented with 50 mM βME (RLT+/βME) and Trizol supplemented with 50 mM TCEP (Trizol/TCEP). The reduction of DTDP was quantified by measuring the absorption of 2-thiopyridione (2-TPD) at 343 nm using an Ultrospec 2000 (80-2106-00, Pharmacia Biotech). 980 μl of lysis solution was prepared in UV-cuvettes and 20 μl of 1 mM DTDP solution added. The solution was briefly mixed by pipetting and absorption measurements started 10 s after DTDP addition. All experiments were repeated three times (n = 3).

Data are represented as mean ± standard error of mean (SEM). Two groups were compared by unpaired t-test (p < 0.05). For comparisons of qPCR data, groups were analyzed by ordinary one-way analysis of variance (ANOVA, p < 0.05). For comparisons in the DTDP assay, groups were analyzed by repeated measures one-way analysis of variance (ANOVA, p < 0.05). Significant effects in ANOVA were further analyzed by multiple comparison with Tukey’s post hoc test (adjusted p-value < 0.05). Graphs and statistics were prepared using the software GraphPad Prism 9. Contrast in microscopy pictures of Figure 5B was enhanced in Adobe PhotoShop 2021. Chemical reactions were drawn in ChemDraw19.

A sperm cell is composed of a head containing a nucleus that carries the paternal genome and RNA, and a flagellum prolonging the head through a mitochondria-rich midpiece, that provides motility (Figure 1A). We incubated mouse sperm cells at room temperature in Trizol, a commercially available AGPC RNA extraction reagent containing guanidinium thiocyanate as chaotropic agent. To separate sperm heads from the midpiece and flagellum, and dissociate cell clumps, we passed the sperm samples 10 times through a 30 G needle at the beginning of Trizol incubation. Despite this treatment, sperm heads remained intact after 5 min of incubation, indicating inefficient lysis (Figure 1A). We repeated the procedure and made it more stringent by using longer incubation (30 min) in Trizol and strong homogenization with small steel beads at 20 Hz for 10 min. However, intact sperm heads still remained visible (Figure 1A). These results confirm previous observations that 2 M guanidinium does not lyse sperm heads (Flaherty and Breed, 1983).

We examined if other commercially available RNA extraction solutions are more efficient. Buffer RLT+ is a proprietary lysis solution of the Qiagen RNAeasy Mini kit, whose composition is unknown. However, the material safety data sheet suggests that it contains up to 50% guanidinium thiocyanate, thus resembles chaotropic properties of Trizol. Buffer RLT+ did not allow sperm lysis either (Figure 1A) even with a prolonged incubation of 18 h at room temperature. However, complete lysis of sperm heads was achieved within 2 min when 100 mM β-mercaptoethanol (βME) was added to Buffer RLT+ at room temperature (Figure 1B). βME is a commonly used reducing agent that breaks inter- and intradisulfide bonds formed between cysteine residues in proteins. The addition of βME is recommended by the manufacturer of the RNAeasy Mini kit to inhibit RNAse, especially when extracting RNA from pancreas and spleen, tissues rich in RNAse.

We extracted RNA from Trizol and Buffer RLT+/βME sperm lysates using a standard phenol-chloroform protocol. To exclude contamination by testicular somatic cells, we prepared sperm samples using a swim-up method followed by treatment with a somatic cell lysis buffer. This approach has previously been shown to yield sperm samples free of somatic cells (Peng et al., 2012; Bianchi et al., 2018). We observed cell debris but no discernible somatic cells in the samples before RNA extraction. We assessed the quality of the extracted RNA by gel electrophoresis. Sperm samples were free of distinct 18S/28S rRNA peaks and had the expected RNA profile (Figures 1C,D), whereas RNA from testes had two characteristic peaks at 1,800 and 3,800 nt for 18S and 28S ribosomal RNA, respectively, and are apparent that indicate high-quality RNA (Figure 1E), suggesting no contamination by somatic cells.

These results indicate that the standard protocol for AGPC RNA extraction is inappropriate to completely lyse mouse sperm cells and is the main reason for poor RNA yield from these cells, and that using Buffer RLT+/βME instead of AGPC solutions circumvents this issue.

We next examined the reason for the lysis-resistance of sperm outer membrane. Sperm cells are lysed by Buffer RLT+ only if supplemented with βME despite the presence of guanidinium thiocyanate as main chaotropic agent. βME is a widely used reducing agent that disrupts disulfide bonds between thiol groups such as cysteine residues, within and between proteins (Figure 2A). During RNA extraction, it inhibits ribonuclease activity and prevents the degradation of RNA released in solution. We tested if adding a reducing agent to AGPC solution results in the successful lysis of sperm cells. Trizol with 100 mM βME however did not lead to the lysis of sperm heads, which remained intact (Figure 2C). Similarly, Trizol supplemented with dithiothreitol (DTT, Figure 2B) did not induce lysis (Figure 2C) even if DTT has been shown to decondense sperm heads by reducing disulfide bonds in protamines (Flaherty and Breed, 1983; Zirkin et al., 1989).

We then examined if the pH of the lysis solution influences the efficiency of sperm lysis. The pH primarily affects the reactivity of reducing agents and an alkaline pH is necessary for efficient reduction of disulfide bonds by βME and DTT (Han and Han, 1994). In contrast, an acidic pH is preferred for protein disulfide bond mapping by mass spectrometry because it preserves disulfide bonds (Lakbub et al., 2018). We measured the pH of several commercially available RNA extraction solutions and observed that Trizol and other AGPC lysis buffers have a pH of 3 while guanidinium thiocyanate in water has a pH of 5 and Buffer RLT+ and lysis buffer from mirVana RNA extraction kit using silica-columns have a pH of 6 (Table 1). The low pH may explain why βME did not improve lysis by Trizol.

Finally, we confirmed the pH-dependent activity of reducing agents by measuring the amount of 2-thiopyridione (2-TPD) formed after reduction of 2,2′-dithiodipyridine (DTDP) in lysis solutions. DTDP mimics protein disulfide bonds between cysteines and absorbance at 343 nm of 2-TPD in solution indicates the amount of disrupted bonds (Figure 3A). Trizol, Buffer RLT+ or 1 M guanidinium thiocyanate did not reduce DTDP. However, Buffer RLT+ supplemented with 50 mM βME led to rapid (within 40 s) and complete reduction of DTDP in water [Figure 3B, ANOVA, F(1.000, 6.000) = 31.6, p = 0.0014]. When added to Trizol, 50 mM βME led to only slow and incomplete reduction of DTDP, with 25% remaining after 60 s [Figure 3C, ANOVA, F(1.171, 7.026) = 29.94, p = 0.0007].

In summary, the supplementation of acidic AGPC solutions with βME or DTT is not sufficient to lyse mouse sperm, likely because guanidinium thiocyanate cannot reduce disulfide bonds present in the sperm head membrane, and the reactivity of βME is pH dependent.

Tris(2-carboxyethyl)phosphine (TCEP) was previously shown to effectively reduce disulfide bonds across a wide pH range from 1.5 to 8.5 (Figure 4A; Han and Han, 1994). Therefore, we first assessed if TCEP could be an effective reducing agent for acidic lysis solutions. In contrast to βME, Trizol supplement with 50 mM TCEP rapidly reduced all DTDP within 10 s [Figure 4B, ANOVA, F(1.458, 8.747) = 28.96, p = 0.0002].

Next, we examined if lysis of sperm cells was improved by supplementing AGPC lysis solutions with TCEP. We observed complete lysis of all sperm heads in Trizol with 50 mM TCEP at room temperature within 5 min (Figures 5A,B). As expected, complete sperm lysis improved the efficiency of RNA extraction without requiring any adjustment or additional recovery step of the standard AGPC protocol. 1 million sperm cells yielded 30 ng RNA when lysed by Trizol/TCEP, thereby considerably improving RNA yield (Figure 5C). Sperm RNA profile had no distinct 18S/28S ribosomal peaks indicating that the source of increased RNA was from sperm cells rather than contamination by somatic cells (Figure 5D). Similarly to Buffer RTL+/βME, extraction by Trizol/TCEP from testis tissue yielded high-quality RNA (Figure 5E). We observed the likely presence of genomic DNA in the RNA profiles of a sperm sample (Supplementary Figure 1A). Subsequent DNA quantification by fluorometry showed the presence of genomic DNA in all sperm RNA samples [Supplementary Figure 1B, ANOVA, F(3, 12) = 18.55, p < 0.0001]. Therefore, all samples were DNAse treated before further use. To exclude RNA degradation, somatic RNA samples were processed in parallel and no substantial decrease in RNA integrity values was observed (Supplementary Figure 1C).

Finally, we confirmed that the RNA extracted by Trizol and TCEP was suitable for downstream applications such as reverse transcription polymerase chain reaction (RT-PCR). To determine the differences in RNA yield by quantitative PCR (qPCR), all sperm samples were processed similarly from lysis to final reverse transcription without any adjustment to volumes at the different processing steps. This ensured that initial differences in RNA quantity remained until qPCR and were quantified by reporting the cycle threshold number (Cq). First, we conducted qPCR on miR-141 [Figure 6A, ANOVA, F(3, 12) = 30.42, p < 0.0001], miR-101b [Figure 6B, ANOVA, F(3, 12) = 9.15, p = 0.002], and miR-200c [Figure 6C, ANOVA, F(3, 12) = 25.34, p < 0.0001]. Lower cycle values in qPCR indicate faster amplification and therefore higher RNA concentration in the sample. We observed significantly faster amplification of RNA samples obtained from lysis in Trizol/TCEP and RLT+/TCEP when compared to incomplete lysis (Figures 6A–C).

Next, we conducted qPCR on the reference gene β-actin and detected significantly faster amplification in sperm RNA samples obtained from lysis with Trizol/TCEP and RLT+/TCEP [Figure 6D, ANOVA, F(3, 12) = 22.6, p < 0.0001]. Furthermore, we conducted end-point PCR for two less abundant genes, metastasis associated lung adenocarcinoma transcript 1 (Malat1) and germ-cell specific phosphoglycerate kinase 2 (Pgk2). Malat1, a long non-coding RNA expressed in many mouse tissues (Hutchinson et al., 2007), amplified in sperm, testis, epididymis and liver RNA samples extracted by Trizol/TCEP (Figure 6E). In contrast, Pgk2 only amplified in sperm and testis samples (Figure 6F). In addition, we performed qPCR for Malat1 and Pgk2. However, all sperm samples amplified above 40 cycles and were considered as not detectable (data not shown; Bustin et al., 2009).

In conclusion, the supplementation of AGPC with TCEP enhances the lysis and RNA extraction from sperm cells, and considerably increases the RNA yield from these cells.